>Mlig086523.g1 {REF} Mlig086523.g1 {Length: 1378} {Pfam: Double-stranded RNA binding motif [PF00035.26, score=66.0]; Staufen C-terminal domain [PF16482.5, score=31.0]; double strand RNA binding domain from DEAD END PROTEIN 1 [PF14709.7, score=25.3]} {Human: ENSG00000180228, PRKRA, protein activator of interferon induced protein kinase EIF2AK2, [Score=69.7, Expect=6e-13]} {Mouse: ENSMUSG00000002731, Prkra, protein kinase, interferon inducible double stranded RNA dependent activator, [Score=67.0, Expect=3e-12]} {Dmel: FBgn0032515, loqs, loquacious, [Score=85.5, Expect=3e-18]} {Smed: dd_Smed_v6_9213_0_1, dd_Smed_v6_9213_0_1, [Score=67.8, Expect=1e-12]} {RNA1509_26241, RNA1509_2973, RNA1509_323, RNA1509_346, RNA1509_4547}
GTAATATGCAAAAAATTGTCTCTGGCAGAAAGTGTCAGCTACTTTGCTACACCCAATTCGCAAAGCTGCATTCTGTACCA
AAATCATAGTCTATGGCTGCTCCCTCTCTCACGGGAGACGGTTTTGAAGAGTAAAGCTTGATTACTTGACCGCTCCTCAA
GGATTCGGTTCGACCGAGCAGCGACCGTCCCTCCTTCAGCAGTTCTTCTAAGCACGCGGTGTTTCTAAACGGCTCACTAT
AATCCAACAAACACGCGATGGCCAGCAAGATTTTCTCCACTGCTGCGGCTCTAGTTGACAAGAAGAGTGGCAAGAAGCAG
CAGCAGCAAAACAAGAAGCCCGAACAACCGATGCCGCAGCCTCAGCCCCTGAAGCCTACCGAACCTACCGAGAGCCTCGA
CGTCAAGAAGACGGACATTGTCAAGCCAGTCGAAGACAATCCAGTCGGTCGACTTCAAGAACTCTGCCAGCAACGACTGT
GGCCGCTGCCCTCCTACACGTTCGAGTGTAGCAACGTCGACAATCCGAGCAAGCGCCAGTTCACCTGCACTGTGAAGCTT
CAGGGTCACACCGACAGAGGCGTTGGACGCTCCAAGCAACTGGCTAAGCGAGCCTGCGCCCAGGCCATGCTGCAACAGTT
GGCAGCCTGCACGGAAGCAAACTGCTGCCAGTCCGCCCTGGCTGAGATAAAAAAAAGCACCGCCGGAGGCGGCAACAACA
AGAAGAAGGCGGCGGCGGCTGCGTCAGCTCAGCAGAAGCCGGCAACTCCGCCGCCAAGTCCGCTGGACGAGGCCGCATTC
CAAGAGTTGCGCTCGTCCAAGCGACTTCAGTCGGCTGCTCGCGCTGGCGCCGAAGTCAATGGACTGTTCCGCGGAGTGAG
AAACCGCAAGGCCGGCGCAACGCTGCCGCCTCTGCAGGAGACGCCAACAGCCGGTCCCAGCAGCGCCAGCGACCAGCTGA
TGGAGCTGAGCAAGCAGCACCGATTCGGGGTGCAGTTCCTTGACAACGGCTCCGACAACAGCAGCGGACAATACCGAGCC
GTTGTCAAACTATCCACTATGCCGACTATCGTTGCTGTTAGCAACGGAGCAAGCGTCGCCAACGCCAAAGAACAGGCTTG
CCGAGCCGCCATAGAGTACCTGTGCTCGTTGACGCGAGAATCTACGGGACCCGCCGGCAAGAAAGCCTAGCTGTTGAACT
CTTCACCCCCGCTGCCCAGCGCGCTCGATTTGAAACTTAGCCAACTGACTGAGACTGATGCTTATAACCTTTTAATTTAA
TTTCTTTGATAATGAAAATAAAAACTGCTGCCTTGCCGCTTTAAAAAACCAGCAGACATTTACAAATAAAAATTTCGGTT
TAAACCAATAAAAATACTC