>Mlig024559.g3 {REF} Mlig024559.g3 {Length: 2467} {Pfam: RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) [PF00076.22, score=211.8]; RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) [PF13893.6, score=43.1]; Occluded RNA-recognition motif [PF16842.5, score=21.5]; RNA binding motif [PF08777.11, score=21.3]; Cytosolic domain of 10TM putative phosphate transporter [PF14703.6, score=19.0]} {Human: ENSG00000162374, ELAVL4, ELAV like RNA binding protein 4, [RH, Score=377, Expect=3e-129]; ENSG00000107105, ELAVL2, ELAV like RNA binding protein 2, [RH, Score=362, Expect=8e-124]} {Mouse: ENSMUSG00000028546, Elavl4, ELAV like RNA binding protein 4, [RH, Score=375, Expect=7e-129]; ENSMUSG00000008489, Elavl2, ELAV like RNA binding protein 1, [RH, Score=364, Expect=1e-124]; ENSMUSG00000003410, Elavl3, ELAV like RNA binding protein 3, [RH, Score=357, Expect=2e-121]} {Dmel: FBgn0010263, Rbp9, RNA-binding protein 9, [RH, Score=390, Expect=2e-130]} {Celegans: WBGene00001368, exc-7, [Score=232, Expect=4e-72]} {Smed: dd_Smed_v6_8376_0_1, dd_Smed_v6_8376_0_1, [RH, Score=261, Expect=3e-82]} {Ipul: Ipul008836.g1, Ipul008836.g1, [RH, Score=296, Expect=4e-96]} {RNA1509_13279, RNA1509_16588, RNA1509_2056, RNA1509_226, RNA1509_3227, RNA1509_35023, RNA1509_4267, RNA1509_5511}
ATTGTGCACATCAGCTGCGGCCTCTGCAAGGGCGCGTACCTGTAATTTGGCTAGTTTAACAGTTACTTTAGAACTGTTTT
AAACACGGTCATTTCAACTAGACTGTAACCAATAAAAGTACAACACGGAACTTTGTTAGAATTTCTGCATAGTTTTACGT
TGAAAAGAATTCGCCCCATGCATTGATATTCACTTGTCATTGATATGCACACTGGGGGATGGGGTGGTGGGTCTGCGTTT
GTCTTAAGAGATTTGCTGCAGCCCTGGCCATAGACTAATCAGCGGGAGAGAACTCTGTCGTTTATGGACAGAGTTGCCAA
GTCCCCCGGCAGTACAGGATATCCCAGCCAGAGAAGAGTTTCTTTCAACTAAGCAGATAAAGGTCTTTCGCGTCAATAGC
CCATCACCGAGCATTTTTTCGCGCGCAAGTTAAAGGCAAGACAAAGGAGTTTACTCTGCTCAAAAAGCGCTTAATTCCAT
CGCGAACTTTCAAGTTAAATAGATTTTAGAGCAGCTCTCTCTCTCTTTAAGAACCGATTTAGTCAAACAAAATGACTTCG
ACAGACATTCTGGGCAAGGACACCAACAATTCGTCATGCGGCTCAACTGACAGCGAGAACCGCACCAACCTGATCGTGAA
CTACTTGCCACCCTCGATGGCTCAAGAAGACGTACGCGCCCTATTCTCTAGCATTGGCGAAGTCGAAAGCTGCAAGTTAG
TACGCGACAGGACCACTGGCGAGAGTCTGGGCTACGCGTTTGTCAAGTACATGCAGCCGAAAGAGGCGGACAAGGCCATT
AAGACGCTGAATGGTCTTAGACTGCAGAACAAGACTATAAAAGTGTCTCTGGCGCGGCCGAGCTCCGAGGCCATCAAGGG
TGCCAATCTGTACATCTGCGGTCTTCCCAAACGAATGACCCAGGAGGAGCTGTCGCGCCTGTTCTCCCAGTGCGGCAAGA
TCATCACGCTGCGCATTCTGTACGACAACAAGACCGGCTTGTCGCGCGGCGTCGCTTTCATCCGGTTTGACCAGCGCAGC
GAGGCCGAGGACGCCATCAAGCAGTTGAACGGCTACACACCGGAGGAAGGCTGCGAGCCAATCACGGTGAAGTTTGCCAA
CAGTCCCAGCGCGGCCAGGCAGGAGAGCAGCAATCTGGTGAACAGCTTCCTGAAGCAGTGCAGCATGCACTCGCCATCTG
GCGCCAAGCTGGGCAGCCCCATCCAGCACCTGGCCGCTCTGACCCGCAACTACAACAAGTACCAGAGCCCGATCAACAAT
GGCATCAGCGGCATCGGCGACCTCATGGCCGCGGCCAGCAGCCTGCCGAACTCGGCCCTCCTGGCCCAGTCGATGGTTGC
CCAGGGCGGCGGCATGACTTCCAGCGGCAGCTGGAGCATCTTCGTCTACAACCTGGCGCCGGAGACCGAGGACCGGATTC
TCTGGGAGCTGTTTGGCCCGTTTGGCGCCGTTCAGACGGTGAAGGTGATCCGCGACCCCGGCACCAACAAGTGCCGCGGC
TTTGGCTTCGTCACGATGAGCAACTACGAGGAGGCCCTGCTGGCTATCCAGTCGCTGAACGGCTACACTGTGGGCAACCG
GACCCTGCAGGTCTCCTTCAAGTCGGCCGCCAGTCCAAAGAGCATGGGCGCGGCCAAGGCTTTGAGCGGCATGCTGCGCG
GGCAGACCAGCCCGACCCAGGCCATGAACTGACTGCCAGGCCAGCGTAGGCGCCGGCCGAGACTTCTACCTGCTTAAATT
TAGTTGCCAAAGCAGCCACCAAGCGCGCTATAAACGCGTCGAGGCCCAAAACCCAAGGAGCAGACTTTAAAAAAAACTTA
AACTCGAGAAGGACAAAGAGAGAGACTCGAGGTAGCTTTGCTTCTGTATCTCCGTACGATAGTTCTTTGTTTGCGGTGTT
GCTTTCCAAAAAAAGTTTAAGCAAATTATTTTGCCTGCGGCTCGTTATTCTTTAACGCTTTGTCCGCCGGCCTTTCAGAC
CCCCGCTTCTCTTTCTGCAACTTTTGTGCGACCCCCTGTCCTGTGTCTGATTTCTAGCCAAAGCTTAGTTCGTACCGTAC
TTTCGCCCTGTCTCGAACCCGCCCTCCTGTTTCCTCATCTGACTCTCCGCCTCGCTGCATCGAAATCTATTACAGAAGTC
TCCGCGGCTTGAATTTCGATTTTCCAACTATCATTACTTTGCTCGATCTTCTCCCAGCTTAGGCGCGAAGACGCAAACAA
AATCTCCCCGCATCGTCATCCTTCGTCCATCTGCCTGACGCTGGCACGTTTTTTAAAGTTGATTTTCAACACTAATTTCC
TACGTTCATTGTTTTTTTTTCTTATACGGGTTTCGGTTTTGAATTTTAAATTCTCTTAAAAAATAAATACTTTCAAATCG
ACGACGCCCAACAGCAGAGAGAAACACAGCCGACTCGACCTTTCCCGCATCACGGAATCTTCACTTAG