>Mlig023254.g18 {REF} Mlig023254.g18 {Length: 3192} {Pfam: Hsp90 protein [PF00183.18, score=778.2]; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase [PF02518.26, score=56.1]; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase [PF13589.6, score=40.4]} {Human: ENSG00000080824, HSP90AA1, heat shock protein 90 alpha family class A member 1, [RH, Score=1074, Expect=0.0]; ENSG00000096384, HSP90AB1, heat shock protein 90 alpha family class B member 1, [RH, Score=1058, Expect=0.0]} {Mouse: ENSMUSG00000021270, Hsp90aa1, heat shock protein 90, alpha (cytosolic), class A member 1, [RH, Score=1088, Expect=0.0]; ENSMUSG00000023944, Hsp90ab1, heat shock protein 90 alpha (cytosolic), class B member 1, [RH, Score=1064, Expect=0.0]} {Dmel: FBgn0001233, Hsp83, Heat shock protein 83, [RH, Score=1101, Expect=0.0]} {Celegans: WBGene00000915, daf-21, Heat shock protein 90, [RH, Score=1035, Expect=0.0]} {Smed: dd_Smed_v6_56_0_2, dd_Smed_v6_56_0_2, [RH, Score=1131, Expect=0.0]} {Ipul: Ipul004370.g2, Ipul004370.g2, [RH, Score=1043, Expect=0.0]} {RNA1509_125, RNA1509_12816, RNA1509_2660, RNA1509_32, RNA1509_7931, RNA1509_9405}
AAATGTATAATTTTTACATCAAGGAAATAATACGAAACTAAACTGAGACAAGGCCTTTATGCTTCAACTGCCAATCTGCC
ATAATCATGGGATGATTGTGAGTCACTGCCGCCCGGCGCCCAGGAAACGGGCGGAGGGGGTGCAGGAGGTAAGGAAAAGG
CAGGCGGGGCGGGTCTAAAAATAGACACTTCACCGAGCACAGCCCGGCGTATTGTAGAGAAAGCCAGTCTAAAAATAGAA
AAGCAGCGGGTTTCCCTTCTAGAATTCTGATTCTAGAATATTCTAGAATAAAAAGAGAATCCATGGATTTCCAAGCCCGC
ACCAAAGCTATATAAGCAGCCAATTCGCGGCCCGCTCGGAGCCTTACTGAAATTCTTACTCTGAAGCTGTTCACAGTGCG
CACTCAAGCGTTAGCATTTGTATTTAATATTAAAACCGTATCAGAAGCTGCAGAGACAACAGAATGGCTGATACCGAGGT
TGAGACTTTCGCCTTCCAGGCCGAGATTGCTCAGTTAATGAGCTTGATCATCAACACTTTCTATTCTAACAAGGAAATCT
TCCTTCGTGAGCTCATTTCCAACGCTAGCGATGCTATTGACAAGATTCGCTACCAGAGCCTCACGGATTCGTCGGTTCTG
GATAGCGGACGCGATCTGGAAATCAAGATCATCCCTAACAAGAGCGACAATTCTCTGACCATCATCGACAGTGGCATCGG
TATGACCAAGGCCGATCTGGTCAACAACCTTGGTACCATCGCTCGCTCTGGCACCAAGGCCTTCATGGAGGCGCTGCAGG
CTGGCGCTGATATCAGCATGATTGGTCAGTTCGGTGTTGGCTTCTATTCTGCCTACCTTGTAGCTGACCGTGTTGTTGTT
ACGTCCAAGCACAATGACGACGAGCAATACGTCTGGGAGTCGTCTGCTGGCGGCAGCTTCACCGTCCGGCCAGACCATGG
CGAGCCCATTGGACGCGGCACCAAGATCGTTCTGTACCTGAAAGAGGATCAAACCGAGTACATCGAAGAGAGGAAGGTCA
AGGAGGTCATCAAGAAGCACTCTCAGTTCATTGGTTATCCTATCAAGCTTGTTCTGGAGAAGGAGCGGGAAAAGGAGGTC
AGCGATGACGAAGCTGAGGAAGAAAAGGAAGAGAAGAAAGAAGACGGTGAAGATGCCGAGAAGGAGAAGCCAAAGGTCGA
GGATGATTTGGATGACAATGATGAAGATGAGAAAGGCGACAAGAAGAAGAAAAAGAAGATCAAGGAGAAGTACATTGACG
AGGAGGAGCTGAACAAGACCAAGCCTATCTGGACCAGGAACCAGGACGACATCACTCAGGAGGAGTATGGCGAGTTCTAC
AAGTCCCTGACTAATGACTGGGAGGAGCACCTGGCTGTGAAGCACTTCAGCGTTGAAGGTCAGCTCGAGTTCCGTGCTCT
TCTGTTTGTGCCGAAGCGCGCGCCGTTCGACCTCTTCGAGAACCGAAAGAAGCGCAACAACATCAAGCTGTACGTGCGTC
GCGTCTTTATCATGGACAACTGCGAGGAGCTGATCCCCGAGTACCTGAACTTCATCAAGGGCGTCGTGGACAGCGAAGAT
CTGCCGCTGAACATCAGCCGTGAGATGCTGCAGCAGAACAAGATTCTCAAGGTCATCCGCAAGAACCTCGTGAAGAAGTG
CATGGAGCTGTTCGACGACATCGCCGAGGACAAGGAGAACTTCAAGAAGTTCTACGAGCAGTTCGGCAAGAACCTGAAGC
TGGGCATCCACGAGGACAGCACCAACCGCAAGAAGCTGGCCGACTACCTGCGCTACTACTCCACCAGCTCCGGCGACGAC
TGGACCAGCCTGAAGGACTACGTCAGCCGCATGAAGGAGAACCAGAAGGACATCTACTACATCACCGGCGAGTCGAAGGA
AGCGGTCGCCCATTCCGCCTTTGTTGAGCGTCTGCGCAAGCGCGGCCTGGAGGTGCTGTACATGACCGATCCCATCGACG
AGTACGCCACCCAGCAGCTGCGCGAGTACGACGGCAAGAAGCTCGTCTGCGTCACCAAGGAGGGCCTCGAGCTGCCTGAG
GACGAGGACGAAAAGAAGGCCTTCGAGGAGAAGAAGGCCTCCTTTGAGCCGCTGTGCAAGGTCATGAAGGACATCCTGGA
CAAGAAGGTCGAGAAGGTGGTCGTGTCCAACCGGCTGGTTGACTCGCCCTGCTGCATCGTCACGTCGCAGTACGGCTGGT
CCGCCAACATGGAGCGCATCATGAAGGCGCAGGCTCTGCGCGACTCCTCAACCATGGGCTACATGGCGGCCAAGAAGCAC
CTGGAGATCAACCCCGACCACTCCATCTGCGGGATGCTGAGGCAGCGCACCGAGGCCGACAAGAACGACAAGTCGGTGAA
GGACCTGGTGCAGTTGCTGTACGAGACCGCCCTGCTGTCGTCTGGCTTCGCCCTGGAGGACCCGCAGGTGCACGCCACCC
GCATCCACCGCATGATCAAGCTGGGCCTCGGCATCGAGGAGGACGACGTCCCTGACGCCGCCGCCGGCGAGTCCTCGTCT
TCCATGCCAACTGAGGTCGGCGGCGATGCCAACGCCGACGACGCCAAGATGGAGGAGGTCGACTAAGGCTGCAGCTTCGA
TCGGAGGGCGCGCTGGTGCGGGGGCAAATCCGTCTCCGTGACTGCATTTAGCCTGTGCGCGCCACTGACCTGACAGACTG
TAACTGGTTCCCCGTTTTGACGCCAGCATGCTAGTAATCACAATTTTATATATTCAAGTTTTCTTAGTAATACTGCGTAT
TTTTTACTCCGGTCAGTGGCTTGCTCGGCAATCTTTAACTGCAGAATTGAAAATTTGCCCGGTATTTGAGAGTTTTGCGC
AGTTCAGATGATATCAGCAGTGTACGGAGTAATTAATATTATTTATTACTATTTATTAACTCGACGGCGTTTAATACCAA
CTAATAATATAAAATATTAATTATTCAGAATTTCTCATCAGTTTGACGTAACAACAATAGGCTCTTTTTACTTTGGTTCC
AACATCATTTGCAGCTTTTCTAATGCTTCTGTGCAGAGTGACGGCTTTGTTAAAGTCTCGGTGAAAAATATTAATAAAAT
ATTCAATTGTGCCGCTGTTTTGCGCCGACTGCGCAAGTAAAGTTCTATCTGCAAACAAATTCTTCGTTACTTT