>Mlig015634.g1 {REF} Mlig015634.g1 {Length: 2042} {TRANSSPLICED} {Pfam: Mitochondrial carrier protein [PF00153.27, score=200.5]} {Human: ENSG00000005022, SLC25A5, solute carrier family 25 member 5, [RH, Score=289, Expect=6e-97]; ENSG00000169100, SLC25A6, solute carrier family 25 member 6, [RH, Score=288, Expect=1e-96]; ENSG00000151729, SLC25A4, solute carrier family 25 member 4, [RH, Score=286, Expect=7e-96]; ENSG00000151475, SLC25A31, solute carrier family 25 member 31, [RH, Score=280, Expect=4e-93]} {Mouse: ENSMUSG00000031633, Slc25a4, solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4, [RH, Score=288, Expect=7e-97]; ENSMUSG00000016319, Slc25a5, solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 5, [RH, Score=286, Expect=7e-96]; ENSMUSG00000069041, Slc25a31, solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31, [RH, Score=277, Expect=4e-92]; ENSMUSG00000116218, Slc25a31, solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31, [RH, Score=277, Expect=4e-92]} {Dmel: FBgn0003360, sesB, stress-sensitive B, [RH, Score=278, Expect=1e-92]} {Celegans: WBGene00010485, ant-1.3, Adenine Nucleotide Translocator; Mitochondrial adenine nucleotide translocase 1.3, [RH, Score=271, Expect=3e-90]} {Smed: dd_Smed_v6_15010_0_1, dd_Smed_v6_15010_0_1, [RH, Score=519, Expect=0.0]} {Ipul: Ipul004310.g10, Ipul004310.g10, [RH, Score=487, Expect=2e-175]} {RNA1509_121, RNA1509_1557, RNA1509_16679, RNA1509_16723, RNA1509_17586, RNA1509_1825, RNA1509_22609, RNA1509_2369, RNA1509_27583, RNA1509_29138, RNA1509_33}
AGACGGCGTTGCTAGACAACTAAGCCCTAAATTTAACGTTTTTTCTCTAAACTTAATCGCTAAATCAACACAAACGCAGC
AATGGGAGAAGGTGGAGCTTACATGAAGGATCTGTCGTTCGCTGAGAACTTTGGCCTGTCTGGCGCCGCTGCAGTCATCT
CCAAGACTGCCGCTGCCCCTATCGAGCGCGTCAAGCTGCTGGTGCAGAACCAGGCCGAGATGATCAAGACTGGCCGTCTG
GACAAGCCATACACCGGCGTCATCGACTGCACGGTGCGCACCTTCCGCAACGAGGGCCTCCTGCCGTTCTGGCGCGGCAA
CCTGGCTAACTGCATCCGGTACTTCCCAACTCAGGCGCTTAACTTCGCTTTCAAGGACAAGATTAAGGCCACCTTCAATC
CGTCCAAGACTGACTCCTACATGGTGTCCTTTGGAAAGAACATCGCCAGCGGCGGCGCCGCCGGAGCCATGTCGCTCTGC
TTCGTCTACTCGCTTGACTATGCCCGTACCCGCCTGGCCAACGACACCAAGTCCGCTAAGAAGGGTGCCGGTGAGCGTCA
GTTCAATGGTCTGCTGGACGTCTACAAAAAGACTCTGGCCTCTGACGGCATCGTTGGCCTGTACCGCGGCTTCGTCATCT
CCTGCGTTGGCATCATGGTCTACCGCGGCTTCTACTTTGGCCTGTACGACACCCTGAAGCCCATCGTGCTGGGTGAGAAC
GCCGGCGTGGCTCTGAGCTTCGTTCTTGGCTACACCGTCACCATCACGGCCGGCCTGATCTCCTACCCGGTTGACACCAT
CCGTAGGCGTATGATGATGACCAGTGGCCAGGCTGTCAAGTACAAGGGCAGCGTCGACTGCGCCGTGCAGATCGTGAAGA
CCGAAGGCTTCATGAGCATGATGAAGGGAGCCGGAGCCAACATTCTCCGCGGTGTGGCTGGCGCCGGTGTGCTGGCTGGC
TTCGACAAGTTCAAGGAGATCTACGTGTCCTTCCGCTTGCCCAAGAAGCCCAAGAATTAAATAATAACAACCAGAACTTA
TTGATGTGGGACATTAATTGACGGCACCCGGATTACAATTAGGATCTGCGGCTCTTATGTCGGACAGAATATATTAATAA
AAATTGTTTAGCATAACACCAACAGTAGTACAATGTCGCCTCCCCTCCTAACTGCGTTCGAATATGATATCTCCTATTTT
CGTATCTCCTAATTTGTCACCAGACTAGGAGAGAATTTCTAAATGCTAAATATAGGCTCTTAAAAAGAGAAACATGAACC
AAAAAATGCAACAATTTTTCTACTGACACCGACATAGCTATAATAAACTATAATATTGTCTAAACTAATTATACTAGCAG
TAGTCCTTAGAAATGTGCGCGTTTTTGTTTGCATCCCCTCTCCCTCCTCAAGCCTCCTAACTTTCTGTTACCCGCCGGCA
GTCTGTCTTTGGGGTTCACAAACAGAAGTTTTCATTTCCCCTATCTATAATTTTATTTATCAATTTATTCTACTAATAAT
ATTCCCACAGAATCTTAGTCCACCAAAAACTGTCAATCTGTTTGAAGCAAAAGAATTTGCACTCTACTGTTTCTGTCTCA
TTTATTTTAGCTTCAGAATTGAGTTTAGTAGTTTTGCTTTGTAGTTGGTTTCAAAATTTAGAGGAATTAATTAAATGCTA
TAGTAATAACAACTAACTGATCGGTTTTGTGTTCTGCGCTACAAACGGAACCTCAATTTTCTGGCTACCGTTTTTCGAGA
AACTCTTGCTGCGCTGGGGTGAACTTTCGAGTCAATGAAATGCGTGTTCGGAATCATTCACTGCCGACTGTATAATGCAA
GGCAAAACAACTTCGTCGAGCTGGAATTATCTAGGCCCAGTTTAATAAATCAACACAGCACGGCATCGAGACAGTGCAAA
TGGCTAAAATTAGTGTTATTATTTCGGAAGGTTAATAGTTAATAAATTAATCAAATAAAAAATTTCTCATAACAATTTAG
TGAAAACATCCTTTTTCGCAGTTTTGGTCTGCGATAGAAATAT